View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_254 (Length: 252)
Name: NF0412_low_254
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_254 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 6960432 - 6960656
Alignment:
| Q |
1 |
catatggtacatattcatatttatttattagaaacaaaatgattttaattagaatttgtatttggtagataatccatctggttttccatattgtttctgt |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6960432 |
catatggtacatatttatatttatttattagaaacaaaatgattttaattagaatttgtatttggtagataatccatctggttttccatattgtttctgt |
6960531 |
T |
|
| Q |
101 |
tgtttaattgtttctgtttgatgttcatatgttacaggacacattcttgggggaaattctaggtgctgttgtcctagctaatggtcattcaagtcttcta |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6960532 |
tgtttaattgtttgtgtttgatgttcatatgttacaggacacattcttgggggaaattctaggtgctgttgtcctagctaatggtcattcaagtcttcta |
6960631 |
T |
|
| Q |
201 |
gatgcaaaatttgagttaaaatctg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
6960632 |
gatgcaaaatttgagttaaaatctg |
6960656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 110 - 225
Target Start/End: Original strand, 6967936 - 6968051
Alignment:
| Q |
110 |
gtttctgtttgatgttcatatgttacaggacacattcttgggggaaattctaggtgctgttgtcctagctaatggtcattcaagtcttctagatgcaaaa |
209 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6967936 |
gtttgtgtttgatgttcatatgttacaggacacattcttgggggaaattctaggtgccgttgtcctagctaatggtcattcaagtcttctagatgcaaaa |
6968035 |
T |
|
| Q |
210 |
tttgagttaaaatctg |
225 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
6968036 |
tttgagttaaaatctg |
6968051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 150 - 185
Target Start/End: Original strand, 48560156 - 48560191
Alignment:
| Q |
150 |
ggggaaattctaggtgctgttgtcctagctaatggt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
48560156 |
ggggaaattctaggtgctgttgtcctagctaatggt |
48560191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 398 times since January 2019
Visitors: 3060