View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_259 (Length: 251)
Name: NF0412_low_259
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_259 |
 |  |
|
| [»] chr4 (6 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 177 - 251
Target Start/End: Original strand, 5181476 - 5181550
Alignment:
| Q |
177 |
ccatttcctctttgacgcgatagtatgccgacttcaatgagtaaatgacatcttaatcatattcccataccaatt |
251 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
5181476 |
ccatttcctctttgacgcgataggttgccgacttcaatgagtaaatgccatctttatcatattcccataccaatt |
5181550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 178 - 251
Target Start/End: Original strand, 5159249 - 5159322
Alignment:
| Q |
178 |
catttcctctttgacgcgatagtatgccgacttcaatgagtaaatgacatcttaatcatattcccataccaatt |
251 |
Q |
| |
|
||||| |||||||||||||||| |||| ||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
5159249 |
cattttctctttgacgcgataggttgccaacttcaatgagtaaatgccatctttatcatattcccataccaatt |
5159322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 228
Target Start/End: Original strand, 5194831 - 5194882
Alignment:
| Q |
177 |
ccatttcctctttgacgcgatagtatgccgacttcaatgagtaaatgacatc |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5194831 |
ccatttcctctttgacgcgatagtatgccgacttcaatgagtaaatgccatc |
5194882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 178 - 239
Target Start/End: Complemental strand, 4843339 - 4843278
Alignment:
| Q |
178 |
catttcctctttgacgcgatagtatgccgacttcaatgagtaaatgacatcttaatcatatt |
239 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
4843339 |
cattttctctttgacgcgatagtttgccgacttcaatgagtaaatgccatctttatcatatt |
4843278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 138 - 176
Target Start/End: Complemental strand, 4843461 - 4843423
Alignment:
| Q |
138 |
gaaaaaatatgttttgtcactctccacataatactcttt |
176 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
4843461 |
gaaaaaatatggtttgccactctccacataatactcttt |
4843423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 142 - 176
Target Start/End: Original strand, 5172102 - 5172136
Alignment:
| Q |
142 |
aaatatgttttgtcactctccacataatactcttt |
176 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
5172102 |
aaatatgttttgccactctccacataatactcttt |
5172136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University