View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_262 (Length: 250)
Name: NF0412_low_262
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_262 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 30 - 112
Target Start/End: Original strand, 5952525 - 5952607
Alignment:
| Q |
30 |
cttgcactagctcaaagtagttggatgaatgtgtcgaagttagttgatgtttaagtagcatttcatcctgtgtgtacttgcct |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5952525 |
cttgcactagctcaaagtagttggatgaatgtgtcgaagttagttgatgtttaagtagcatttcatcctgtgtgtacttgcct |
5952607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 181 - 250
Target Start/End: Original strand, 5952682 - 5952751
Alignment:
| Q |
181 |
gaagtcaaagatgatgatttaatccaattgaatgctaatcaccagaagagttccaagttgcaatttaatt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5952682 |
gaagtcaaagatgatgatttaatccaattgaatgctaatcaccagaagagttccaagttgcaatttaatt |
5952751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University