View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_27 (Length: 436)
Name: NF0412_low_27
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 30 - 257
Target Start/End: Original strand, 27243818 - 27244046
Alignment:
Q |
30 |
gctactactcaaaggtaataatagatcaatgtttacaactatcataagagcactatcactctctcaccaatttacaatgcggtgttaacg-ttaaggatg |
128 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
27243818 |
gctactactcaaaggtaataatagatcaatgtttacatctatcataagagcactatcactctctcaccaatttacaatgcggtgttaactattaaggatg |
27243917 |
T |
 |
Q |
129 |
tagagacaaatgatatttgatcgatcaatcgatcccatcaaattgttttcttgatgatggttgaaaaatcaatctaaagacttccactgatttgaatcat |
228 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
T |
27243918 |
tagagacaaatgatatttgatcgatcaatcgatcccatcaaattgttttcttgatgatggttgaaaaatcagtctaaggacttccactgatttgaatcat |
27244017 |
T |
 |
Q |
229 |
tggttaattcatctgcttagtgtttatga |
257 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
27244018 |
tggttaattcatctgcttagtgtttatga |
27244046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 353 - 418
Target Start/End: Original strand, 27244144 - 27244209
Alignment:
Q |
353 |
cgaaaatgttgtatttaacgaaaataatttcgtgaaagatagcaaacaaatgtattgttactatag |
418 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
27244144 |
cgaaaatgttgtatataacgaaaataatttcgtgaaagatagcgaacaaatgtattgttactatag |
27244209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1004 times since January 2019
Visitors: 3074