View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_270 (Length: 248)
Name: NF0412_low_270
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_270 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 30941891 - 30941977
Alignment:
| Q |
1 |
tttggtcaatacttgaacaacatgagaccaccagttccactttcacagtgcaatagcaaccatgttttggatttccttcgttactta |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30941891 |
tttggtcaatacttgaacaacatgagaccaccagttccactttcacagtgcaatagcaaccatgttttggatttccttcgttactta |
30941977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 39556402 - 39556472
Alignment:
| Q |
1 |
tttggtcaatacttgaacaacatgagaccaccagttccactttcacagtgcaatagcaaccatgttttgga |
71 |
Q |
| |
|
|||||||||||||| |||||| | |||||||| ||||||||||| || |||||| ||||||||| ||||| |
|
|
| T |
39556402 |
tttggtcaatacttaaacaacctaagaccacccgttccactttctcactgcaattccaaccatgtgttgga |
39556472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University