View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_277 (Length: 244)
Name: NF0412_low_277
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_277 |
 |  |
|
[»] scaffold0238 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0238 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: scaffold0238
Description:
Target: scaffold0238; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 99 - 156
Target Start/End: Complemental strand, 12831 - 12774
Alignment:
Q |
99 |
ctcactgccgtagctttaagccttgatcctcccatccattgcaacatggcacatgatg |
156 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12831 |
ctcactgccgtagctttaagccttgatcctcccatccattgcaacatggcacatgatg |
12774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 99 - 156
Target Start/End: Original strand, 12604113 - 12604170
Alignment:
Q |
99 |
ctcactgccgtagctttaagccttgatcctcccatccattgcaacatggcacatgatg |
156 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12604113 |
ctcactgccgtagctttaagccttgatcctcccatccattgcaacatggcacatgatg |
12604170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 99 - 156
Target Start/End: Complemental strand, 10452995 - 10452938
Alignment:
Q |
99 |
ctcactgccgtagctttaagccttgatcctcccatccattgcaacatggcacatgatg |
156 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
10452995 |
ctcactgtcgtagctttaagccttgatcctcccatccattgtaacatggcacatgatg |
10452938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University