View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0412_low_277 (Length: 244)

Name: NF0412_low_277
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0412_low_277
NF0412_low_277
[»] scaffold0238 (1 HSPs)
scaffold0238 (99-156)||(12774-12831)
[»] chr1 (1 HSPs)
chr1 (99-156)||(12604113-12604170)
[»] chr2 (1 HSPs)
chr2 (99-156)||(10452938-10452995)


Alignment Details
Target: scaffold0238 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: scaffold0238
Description:

Target: scaffold0238; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 99 - 156
Target Start/End: Complemental strand, 12831 - 12774
Alignment:
99 ctcactgccgtagctttaagccttgatcctcccatccattgcaacatggcacatgatg 156  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12831 ctcactgccgtagctttaagccttgatcctcccatccattgcaacatggcacatgatg 12774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 99 - 156
Target Start/End: Original strand, 12604113 - 12604170
Alignment:
99 ctcactgccgtagctttaagccttgatcctcccatccattgcaacatggcacatgatg 156  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12604113 ctcactgccgtagctttaagccttgatcctcccatccattgcaacatggcacatgatg 12604170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 99 - 156
Target Start/End: Complemental strand, 10452995 - 10452938
Alignment:
99 ctcactgccgtagctttaagccttgatcctcccatccattgcaacatggcacatgatg 156  Q
    ||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||    
10452995 ctcactgtcgtagctttaagccttgatcctcccatccattgtaacatggcacatgatg 10452938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University