View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_286 (Length: 232)
Name: NF0412_low_286
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_286 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 142 - 204
Target Start/End: Complemental strand, 24737925 - 24737863
Alignment:
| Q |
142 |
aactttgcaagtagatgcataggtgaattaaagttgattttttgacttgaagaagttaactat |
204 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24737925 |
aactttgcaagtagatgcataagtgaactaaagttgattttttgacttgaagaagttaactat |
24737863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 575 times since January 2019
Visitors: 3061