View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_29 (Length: 424)
Name: NF0412_low_29
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 310
Target Start/End: Original strand, 43142270 - 43142579
Alignment:
| Q |
1 |
tagcatggtgtgaatgggaacatgagttgggattggtagatgaggaggagaagtagtggttttcatgttgtgttccattgtgttgtgtgagaaacagagg |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43142270 |
tagcatggtgtgaatgggaacatgaattgggattggtagatgaggaggagaagtagtggttttcattttgtgttccattgtgttgtgtgagaaacagagg |
43142369 |
T |
|
| Q |
101 |
aaaacagagagattgttaatattaattcaatggatactttttctcttgctttgtaacatggtatggaaactaaaggatgtgtttggctatatttatagac |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43142370 |
aaaacagagaggttgttaatattaattcaatggatactttttctcttgctttgtaacatggtatggaaactaaaggatgtgtttggctatatatatagac |
43142469 |
T |
|
| Q |
201 |
caaaagggaagcatgttgggtcagagttggtgacttcatctcaacgtattatggaagcaatgatgacgatgtattttgataaagccgtataaaatatcat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43142470 |
caaaagggaagcatgttgggtcagagttggtgacttcatctcaacgtattatggaagcaatgatgacgatgtattttgataaagccgtataaaatatcat |
43142569 |
T |
|
| Q |
301 |
gattagatac |
310 |
Q |
| |
|
|||||||||| |
|
|
| T |
43142570 |
gattagatac |
43142579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 799 times since January 2019
Visitors: 3065