View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_290 (Length: 229)
Name: NF0412_low_290
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_290 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 52 - 225
Target Start/End: Original strand, 25642553 - 25642726
Alignment:
Q |
52 |
aataaaagaaatgagtgaagttaaaatctgcatattatgttggctatctagttttcctttcactgtcctgagtttagcagatatcaaaaagaaggtattg |
151 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25642553 |
aataaaagaaatgagtgaagttaaaatctgcatattatgttggctatctagttttcctttcactgtcctgagtttagcagatatcaaaaagaaggtattg |
25642652 |
T |
 |
Q |
152 |
gcacggtacagaaagcattgggtcaaaaagatacatgcattcccttcactgcaattgcacttccttatattctt |
225 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25642653 |
gcacggtacataaagcattgggtcaaaaagatacatgcattcccttcactgcaattgcacttccttatattctt |
25642726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University