View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_292 (Length: 227)
Name: NF0412_low_292
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_292 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 97 - 172
Target Start/End: Original strand, 34723760 - 34723835
Alignment:
| Q |
97 |
cgctagtaatgtaagaggcggnnnnnnngtgcttggcgcttcttcacttgaataatcattcctgttcatctcactc |
172 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
34723760 |
cgctagtaatgtaagaggcagtttttttgtgcttggcgcttcttcacttgaataatcattcctgctcatcttactc |
34723835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 895 times since January 2019
Visitors: 3072