View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_310 (Length: 215)
Name: NF0412_low_310
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_310 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 3741022 - 3741109
Alignment:
| Q |
1 |
tttattgttattgtcgcaaataaaacactaacacacactgtttctttctctgcacaaaacatgaccaaacacaaaaacctttatcttc |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3741022 |
tttattgttattgtcgcaaataaaacactaacacacactgtttctttctctgcacaaaacatgaccaaacacaaaaacctttatcttc |
3741109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 693 times since January 2019
Visitors: 3064