View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_311 (Length: 213)
Name: NF0412_low_311
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_311 |
 |  |
|
[»] scaffold0505 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 7e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 9 - 129
Target Start/End: Original strand, 4892748 - 4892868
Alignment:
Q |
9 |
cgaaattataccttttctttcccttcgatctgcgacgcggtgattatgatcctggtccgttttcgtgatgcttgcttctcgcgtccgatctgcttctctc |
108 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
4892748 |
cgaaattataccttttctttctcttcgatctgcgacgcggtgcttataatcctggtccgttttcgtgatgcttgcttctcgcgtctgatctgcttctctc |
4892847 |
T |
 |
Q |
109 |
tggctttctccttctctgttc |
129 |
Q |
|
|
||||||||| |||||||||| |
|
|
T |
4892848 |
cggctttctctttctctgttc |
4892868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 9 - 70
Target Start/End: Complemental strand, 12662816 - 12662755
Alignment:
Q |
9 |
cgaaattataccttttctttcccttcgatctgcgacgcggtgattatgatcctggtccgttt |
70 |
Q |
|
|
|||| |||||||||||||||| ||||||||||||||| |||| ||||||| ||||||||||| |
|
|
T |
12662816 |
cgaagttataccttttctttctcttcgatctgcgacgaggtggttatgattctggtccgttt |
12662755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0505 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: scaffold0505
Description:
Target: scaffold0505; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 12393 - 12269
Alignment:
Q |
1 |
aagtggcacgaaattataccttttctttcccttcgatctgcgacgcggtgattatgatcctggtccgttttcgtgatgcttgcttctcgcgtccgatctg |
100 |
Q |
|
|
||||| ||||||||||||||||||||||| |||||||||||||||||||| |||| |||||||||||||||||||| ||||||||||||| |||||| || |
|
|
T |
12393 |
aagtgacacgaaattataccttttctttctcttcgatctgcgacgcggtgcttataatcctggtccgttttcgtgaagcttgcttctcgcatccgatatg |
12294 |
T |
 |
Q |
101 |
cttctctctggctttctccttctct |
125 |
Q |
|
|
|||||||||| ||||||| |||||| |
|
|
T |
12293 |
cttctctctgtctttctctttctct |
12269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 13087477 - 13087353
Alignment:
Q |
1 |
aagtggcacgaaattataccttttctttcccttcgatctgcgacgcggtgattatgatcctggtccgttttcgtgatgcttgcttctcgcgtccgatctg |
100 |
Q |
|
|
||||| ||||||||||||||||||||||| |||||||||||||||||||| |||| |||||||||||||||||||| ||||||||||||| |||||| || |
|
|
T |
13087477 |
aagtgacacgaaattataccttttctttctcttcgatctgcgacgcggtgcttataatcctggtccgttttcgtgaagcttgcttctcgcatccgatatg |
13087378 |
T |
 |
Q |
101 |
cttctctctggctttctccttctct |
125 |
Q |
|
|
|||||||||| ||||||| |||||| |
|
|
T |
13087377 |
cttctctctgtctttctctttctct |
13087353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 7 - 70
Target Start/End: Original strand, 30067844 - 30067907
Alignment:
Q |
7 |
cacgaaattataccttttctttcccttcgatctgcgacgcggtgattatgatcctggtccgttt |
70 |
Q |
|
|
||||||||||||||||| ||||| ||||||||||||||| |||| ||||||| ||||||||||| |
|
|
T |
30067844 |
cacgaaattatacctttcctttctcttcgatctgcgacgaggtggttatgattctggtccgttt |
30067907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1285 times since January 2019
Visitors: 3079