View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0412_low_319 (Length: 207)

Name: NF0412_low_319
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0412_low_319
NF0412_low_319
[»] chr4 (1 HSPs)
chr4 (1-130)||(30426619-30426748)


Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 30426748 - 30426619
Alignment:
1 aattgtcgtggtccccatgatggaatataaggcgtgtgctaaaatcatacaaaatatgtgaagaccatatgtgagttttgatggccaaaaaaggttctag 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
30426748 aattgtcgtggtccccatgatggaatataaggcgtgtgctaaaatcatacaaaatatgtgaagaccatatgtgagttttgatggccaaaaaaagttctag 30426649  T
101 aatccaactcaaaattattgattcattcat 130  Q
    ||||||||||||||||||||||||||||||    
30426648 aatccaactcaaaattattgattcattcat 30426619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1009 times since January 2019
Visitors: 3074