View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_325 (Length: 202)
Name: NF0412_low_325
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_325 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 6546 - 6683
Alignment:
Q |
1 |
aaaaagacatatcttttcttaaagattggttacattgatggtccttttgaggaagtttctttgtaactacaaaagtttggatggnnnnnnngagaaattt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
6546 |
aaaaagacatatcttttcttaaagattggttacattgatggtccttttgaggaagtttctttgtaactacaaaagtttggatggaaaaaaagagaaattt |
6645 |
T |
 |
Q |
101 |
tgttttgtaattccagaatccctgaaagctactttcat |
138 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
6646 |
tgttttgtaattccagaatccctgaaagctactttcat |
6683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University