View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0412_low_325 (Length: 202)

Name: NF0412_low_325
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0412_low_325
NF0412_low_325
[»] chr7 (1 HSPs)
chr7 (1-138)||(6546-6683)


Alignment Details
Target: chr7 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 6546 - 6683
Alignment:
1 aaaaagacatatcttttcttaaagattggttacattgatggtccttttgaggaagtttctttgtaactacaaaagtttggatggnnnnnnngagaaattt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||    
6546 aaaaagacatatcttttcttaaagattggttacattgatggtccttttgaggaagtttctttgtaactacaaaagtttggatggaaaaaaagagaaattt 6645  T
101 tgttttgtaattccagaatccctgaaagctactttcat 138  Q
    ||||||||||||||||||||||||||||||||||||||    
6646 tgttttgtaattccagaatccctgaaagctactttcat 6683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1216 times since January 2019
Visitors: 3078