View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_36 (Length: 403)
Name: NF0412_low_36
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 71; Significance: 5e-32; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 107 - 177
Target Start/End: Original strand, 9658261 - 9658331
Alignment:
| Q |
107 |
tggattcataaaccgttaggacaaagagccatcttcaagggacctaaattccctgcataaattattgcgtg |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9658261 |
tggattcataaaccgttaggacaaagagccatcttcaagggacctaaattccctgcataaattattgcgtg |
9658331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 9658197 - 9658250
Alignment:
| Q |
30 |
gtacaaacattgtcgacataaaagnnnnnnnacacatatacatctaagatggtg |
83 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9658197 |
gtacaaacattgtcgacataaaagtttttttacacatatacatctaagatggtg |
9658250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 319 - 392
Target Start/End: Original strand, 2667870 - 2667943
Alignment:
| Q |
319 |
tgggttggcctgtcggtattgtcttgggatctaggagtatgtttttcctcaatgtctccggttcgattatctct |
392 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| ||||| || | |||||| | ||||| ||||||||||||||| |
|
|
| T |
2667870 |
tgggttggcctggtggtattggcttgggatctgggagtgtgctcttcctcgaggtctcaggttcgattatctct |
2667943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 334 - 391
Target Start/End: Complemental strand, 42644963 - 42644906
Alignment:
| Q |
334 |
gtattgtcttgggatctaggagtatgtttttcctcaatgtctccggttcgattatctc |
391 |
Q |
| |
|
|||||| |||||||||| |||| |||| |||||||| ||||| |||||||||||||| |
|
|
| T |
42644963 |
gtattgacttgggatctgagagtgtgttcttcctcaaagtctcaggttcgattatctc |
42644906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000006; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 333 - 393
Target Start/End: Original strand, 6650617 - 6650677
Alignment:
| Q |
333 |
ggtattgtcttgggatctaggagtatgtttttcctcaatgtctccggttcgattatctctg |
393 |
Q |
| |
|
||||||| ||||||||| |||||||| | ||||||||||||| ||||||||| |||||| |
|
|
| T |
6650617 |
ggtattggcttgggatcggggagtatgctcctcctcaatgtctcaggttcgattctctctg |
6650677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 335 - 391
Target Start/End: Original strand, 9964462 - 9964518
Alignment:
| Q |
335 |
tattgtcttgggatctaggagtatgtttttcctcaatgtctccggttcgattatctc |
391 |
Q |
| |
|
||||| |||||||||| ||||| || | |||||||||||||| |||| ||||||||| |
|
|
| T |
9964462 |
tattgacttgggatctgggagtgtgctcttcctcaatgtctcaggtttgattatctc |
9964518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University