View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_46 (Length: 394)
Name: NF0412_low_46
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 29 - 380
Target Start/End: Original strand, 47836595 - 47836949
Alignment:
Q |
29 |
aacacatgttcttgaattccttcactatcttgatcaatttgggaagactaaggttcacaatccaacttgtcctttctttgggatgccaaaccctccatct |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47836595 |
aacacatgttcttgaattccttcactatcttgatcaatttgggaagactaaggttcacaatccaacttgtcctttctttgggatgccaaaccctccatct |
47836694 |
T |
 |
Q |
129 |
ccatgtgcttgtcctctccgtcaggcgtggggtagccttgatgctcttgtcggtcgcctccgcgccgcatatgatcaagagatcaatggtgga---agta |
225 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
47836695 |
ccatgtgcttgtcctctccgtcaggcgtggggtagccttgatgctcttgtcggtcgcctccgcgccgcatatgatcaagagatcaatggtggaagtagta |
47836794 |
T |
 |
Q |
226 |
acccttttggtgatggtgctgttaggttttacttgcgtgatgttcgtgattttcagtcaaaggctagaggagttagctaccataagaaaaggaagagacc |
325 |
Q |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47836795 |
atccttttggtgatggtgctgttaggttttacttgcgtgatgttcgtgatttccagtcaaaggctagaggagttagctaccataagaaaaggaagagacc |
47836894 |
T |
 |
Q |
326 |
taaccgcaacatcacaactatttctcaatcatcctcatgaactcaaatctaaatc |
380 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47836895 |
taaccgcaacatcacaactatttctcaatcatcctcatgaactcaaatctaaatc |
47836949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 52 - 187
Target Start/End: Original strand, 35608631 - 35608766
Alignment:
Q |
52 |
actatcttgatcaatttgggaagactaaggttcacaatccaacttgtcctttctttgggatgccaaaccctccatctccatgtgcttgtcctctccgtca |
151 |
Q |
|
|
|||||||||| || |||||||| || || |||||||| | |||||||||||||||| || || || || ||| |||| ||| | |||||||| ||||| |
|
|
T |
35608631 |
actatcttgaccagtttgggaaaaccaaagttcacaaccatccttgtcctttctttggcatccctaatccaccagctccttgtccatgtcctcttcgtca |
35608730 |
T |
 |
Q |
152 |
ggcgtggggtagccttgatgctcttgtcggtcgcct |
187 |
Q |
|
|
||||||||||| || || ||||| |||||||||| |
|
|
T |
35608731 |
agcgtggggtagtctcgacgctctcatcggtcgcct |
35608766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 224 - 328
Target Start/End: Original strand, 35608806 - 35608910
Alignment:
Q |
224 |
taacccttttggtgatggtgctgttaggttttacttgcgtgatgttcgtgattttcagtcaaaggctagaggagttagctaccataagaaaaggaagaga |
323 |
Q |
|
|
||||||||||||| | || |||||||| |||| || | || |||||||||||||| |||| ||||||| |||||||| | |||||||||||||| |
|
|
T |
35608806 |
taacccttttggttctcgttctgttaggatttatttaagggacgttcgtgattttcaagcaaaatctagaggggttagctatgaaaagaaaaggaagagg |
35608905 |
T |
 |
Q |
324 |
cctaa |
328 |
Q |
|
|
||||| |
|
|
T |
35608906 |
cctaa |
35608910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 33 - 86
Target Start/End: Original strand, 35814573 - 35814626
Alignment:
Q |
33 |
catgttcttgaattccttcactatcttgatcaatttgggaagactaaggttcac |
86 |
Q |
|
|
||||||||||| || |||| || |||||||||||||| ||||||||||||||| |
|
|
T |
35814573 |
catgttcttgattttcttcgttaccttgatcaatttggtaagactaaggttcac |
35814626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1605 times since January 2019
Visitors: 3090