View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_66 (Length: 374)
Name: NF0412_low_66
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 83 - 353
Target Start/End: Original strand, 52761091 - 52761361
Alignment:
| Q |
83 |
ccattaataatggacagtcaatagacccttcaacagatggttgttgaacttcaagctctctctggcgagttgctgcactaatttgtgccgaagagaaaaa |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52761091 |
ccattaataatggacagtcaatagacccttcaacagatggttgttgaacttcaagctctctctggcgagttgctgcactaatttgtgccgaagagaaaaa |
52761190 |
T |
 |
| Q |
183 |
ctccccaacctaaaatggtaaaaacaaataaggaattataaacttgaatctaattgtcttctctaaacacaaacaattaaatatcaacagcttagtgatg |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52761191 |
ctccccaacctaaaatggtaaaaacaaataaggaattataaacttgaatctaattgtcttctctaaacacaaacaattaaatatcaacagcttggtgatg |
52761290 |
T |
 |
| Q |
283 |
gtttaggtgaacattaaaaactataccttctctaaaacaagcttgtactctataagttcattataagtgtg |
353 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52761291 |
gtttaggtgaactttaaaaactataccttctctaaaacaagcttgtactctataagttcattataagtgtg |
52761361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University