View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0412_low_68 (Length: 367)

Name: NF0412_low_68
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0412_low_68
NF0412_low_68
[»] chr2 (1 HSPs)
chr2 (242-334)||(3205974-3206066)


Alignment Details
Target: chr2 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 242 - 334
Target Start/End: Original strand, 3205974 - 3206066
Alignment:
242 atggagagagaattttggggagaatttgaaatttgaaatcagtagtaactgaaagggagggagaaggaaaaggatctggctttggaaagccat 334  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||    
3205974 atggagagagaattttggggagaatttgaaatttgaaatcagtagtaactgaaagggagggagaaggaaaatgatatggctttggaaagccat 3206066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University