View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_68 (Length: 367)
Name: NF0412_low_68
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_68 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 242 - 334
Target Start/End: Original strand, 3205974 - 3206066
Alignment:
Q |
242 |
atggagagagaattttggggagaatttgaaatttgaaatcagtagtaactgaaagggagggagaaggaaaaggatctggctttggaaagccat |
334 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
T |
3205974 |
atggagagagaattttggggagaatttgaaatttgaaatcagtagtaactgaaagggagggagaaggaaaatgatatggctttggaaagccat |
3206066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 745 times since January 2019
Visitors: 3064