View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_81 (Length: 356)
Name: NF0412_low_81
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_81 |
 |  |
|
| [»] scaffold0522 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-140; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 30 - 294
Target Start/End: Original strand, 2665080 - 2665344
Alignment:
| Q |
30 |
cctattacgcctgtagttgttactcctcctgcccctgttacgctttccccaattatcccccttgtccctgctacgcctgcacctgttgagccccctgtag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2665080 |
cctattacgcctgtagttgttactcctccttcccctgttacgctttccccaattatcccccttgtccctgctacgcctgcacctgttgagccccctgtag |
2665179 |
T |
 |
| Q |
130 |
acccttctgcccctattgttgcccctgttgagcctccggttattccaacattccccccattggatgtagctgctccttcttactcatcattgccactgcg |
229 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2665180 |
acccttctgcccctattattgcccctgttgagcctccggttattccaacattccccccattggatgtagctgctccttcttactcatcattgccactgcg |
2665279 |
T |
 |
| Q |
230 |
ccccgcttacatctctagaagattgatggctgttcacttttaagtctcttgcaattgagcctatg |
294 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2665280 |
ccccacttacatctctagaagattgatggctgttcacttttaagtctcttgcaattgagcctatg |
2665344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 127
Target Start/End: Original strand, 2664924 - 2665021
Alignment:
| Q |
30 |
cctattacgcctgtagttgttactcctcctgcccctgttacgctttccccaattatcccccttgtccctgctacgcctgcacctgttgagccccctgt |
127 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| || |||||||| ||| ||||| |||| | ||||| |||||||||||| |||| |
|
|
| T |
2664924 |
cctattacgcctgtcgttgttactcctcctgcccctgttacggttcccccaattgaccctcttgttcctgtaccacctgcccctgttgagcccactgt |
2665021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0522 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0522
Description:
Target: scaffold0522; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 727 - 690
Alignment:
| Q |
46 |
ttgttactcctcctgcccctgttacgctttccccaatt |
83 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
727 |
ttgttacgcctcctgcccctgttacgcttcccccaatt |
690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University