View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0412_low_83 (Length: 353)

Name: NF0412_low_83
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0412_low_83
NF0412_low_83
[»] chr3 (7 HSPs)
chr3 (221-305)||(40941369-40941452)
chr3 (19-114)||(40951510-40951601)
chr3 (115-174)||(40947598-40947657)
chr3 (117-171)||(40941891-40941945)
chr3 (76-117)||(40942021-40942062)
chr3 (20-50)||(40942072-40942102)
chr3 (256-305)||(40928990-40929039)


Alignment Details
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 7)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 221 - 305
Target Start/End: Complemental strand, 40941452 - 40941369
Alignment:
221 caatcaatattctatcagttctgcattcacttttaactgaataaatttaaaatgtttggtcgaaattttgagatcgtagtcaata 305  Q
    |||||||||||||| ||| |||||||||||||||| ||||||||||| ||||||||||||||||||||||| || ||| ||||||    
40941452 caatcaatattctaacagctctgcattcactttta-ctgaataaattaaaaatgtttggtcgaaattttgaaattgtaatcaata 40941369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 19 - 114
Target Start/End: Complemental strand, 40951601 - 40951510
Alignment:
19 gttgtaatgaagagtttaattaccataaaagggaagttttatccatgttttaaataattgttcaacaatcatgatcataaacaagacttctcacca 114  Q
    ||||||||||||||||||    |||||||||||| || |||||| | || |||||||||||||||||||||| ||||| |||||||||||||||||    
40951601 gttgtaatgaagagttta----ccataaaagggaggtgttatccctattgtaaataattgttcaacaatcattatcattaacaagacttctcacca 40951510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 115 - 174
Target Start/End: Complemental strand, 40947657 - 40947598
Alignment:
115 tatggatctagaattctctatagtgatgcaactgtgcagcgctgtagataattgaagtcc 174  Q
    ||||||||| |||||||||||||||||| |||||||| ||||||||||||| ||||||||    
40947657 tatggatctggaattctctatagtgatggaactgtgcggcgctgtagataactgaagtcc 40947598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 117 - 171
Target Start/End: Complemental strand, 40941945 - 40941891
Alignment:
117 tggatctagaattctctatagtgatgcaactgtgcagcgctgtagataattgaag 171  Q
    ||||||| |||||||||| |||||||||||||||||||||| |||||||||||||    
40941945 tggatctggaattctctaaagtgatgcaactgtgcagcgctatagataattgaag 40941891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 76 - 117
Target Start/End: Complemental strand, 40942062 - 40942021
Alignment:
76 ttgttcaacaatcatgatcataaacaagacttctcaccatat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||    
40942062 ttgttcaacaatcatgatcataaacaagacttctcaccatat 40942021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 50
Target Start/End: Complemental strand, 40942102 - 40942072
Alignment:
20 ttgtaatgaagagtttaattaccataaaagg 50  Q
    |||||||||||||||||||||||||||||||    
40942102 ttgtaatgaagagtttaattaccataaaagg 40942072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 305
Target Start/End: Complemental strand, 40929039 - 40928990
Alignment:
256 actgaataaatttaaaatgtttggtcgaaattttgagatcgtagtcaata 305  Q
    |||||||||||| |||||||||||| |||||| |||||| ||| ||||||    
40929039 actgaataaattaaaaatgtttggttgaaattatgagattgtaatcaata 40928990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University