View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_83 (Length: 353)
Name: NF0412_low_83
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_83 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 221 - 305
Target Start/End: Complemental strand, 40941452 - 40941369
Alignment:
Q |
221 |
caatcaatattctatcagttctgcattcacttttaactgaataaatttaaaatgtttggtcgaaattttgagatcgtagtcaata |
305 |
Q |
|
|
|||||||||||||| ||| |||||||||||||||| ||||||||||| ||||||||||||||||||||||| || ||| |||||| |
|
|
T |
40941452 |
caatcaatattctaacagctctgcattcactttta-ctgaataaattaaaaatgtttggtcgaaattttgaaattgtaatcaata |
40941369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 19 - 114
Target Start/End: Complemental strand, 40951601 - 40951510
Alignment:
Q |
19 |
gttgtaatgaagagtttaattaccataaaagggaagttttatccatgttttaaataattgttcaacaatcatgatcataaacaagacttctcacca |
114 |
Q |
|
|
|||||||||||||||||| |||||||||||| || |||||| | || |||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
T |
40951601 |
gttgtaatgaagagttta----ccataaaagggaggtgttatccctattgtaaataattgttcaacaatcattatcattaacaagacttctcacca |
40951510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 115 - 174
Target Start/End: Complemental strand, 40947657 - 40947598
Alignment:
Q |
115 |
tatggatctagaattctctatagtgatgcaactgtgcagcgctgtagataattgaagtcc |
174 |
Q |
|
|
||||||||| |||||||||||||||||| |||||||| ||||||||||||| |||||||| |
|
|
T |
40947657 |
tatggatctggaattctctatagtgatggaactgtgcggcgctgtagataactgaagtcc |
40947598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 117 - 171
Target Start/End: Complemental strand, 40941945 - 40941891
Alignment:
Q |
117 |
tggatctagaattctctatagtgatgcaactgtgcagcgctgtagataattgaag |
171 |
Q |
|
|
||||||| |||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
T |
40941945 |
tggatctggaattctctaaagtgatgcaactgtgcagcgctatagataattgaag |
40941891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 76 - 117
Target Start/End: Complemental strand, 40942062 - 40942021
Alignment:
Q |
76 |
ttgttcaacaatcatgatcataaacaagacttctcaccatat |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40942062 |
ttgttcaacaatcatgatcataaacaagacttctcaccatat |
40942021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 50
Target Start/End: Complemental strand, 40942102 - 40942072
Alignment:
Q |
20 |
ttgtaatgaagagtttaattaccataaaagg |
50 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
40942102 |
ttgtaatgaagagtttaattaccataaaagg |
40942072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 305
Target Start/End: Complemental strand, 40929039 - 40928990
Alignment:
Q |
256 |
actgaataaatttaaaatgtttggtcgaaattttgagatcgtagtcaata |
305 |
Q |
|
|
|||||||||||| |||||||||||| |||||| |||||| ||| |||||| |
|
|
T |
40929039 |
actgaataaattaaaaatgtttggttgaaattatgagattgtaatcaata |
40928990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 612 times since January 2019
Visitors: 3062