View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_84 (Length: 353)
Name: NF0412_low_84
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_84 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 30 - 345
Target Start/End: Original strand, 27309056 - 27309371
Alignment:
| Q |
30 |
gccatcacggatgcaaaaacaattataccctgcatagaaacataagtgtgtgtttttcactctcaatgtattacgaaactactgcattcactcaaatttt |
129 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
27309056 |
gccatcacggatgcaaaaacaatgataccctgcatagaaacataagtgtgtgtttttcactctcaatgtattacgaaactactggattcactaaaatttt |
27309155 |
T |
|
| Q |
130 |
aaacaactcatcaatcgtgttgtagtttaaaatctaagttgtcttaccactggttgcatacgtttctttccaatcggatagtgatatcggtttggcttgc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27309156 |
aaacaactcatcaatcgtgttgtagtttaaaatctaagttgtcttaccactggttgcatacgtttctttccaatcggatagtgatatcggtttggcttgc |
27309255 |
T |
|
| Q |
230 |
tcatggcattggaagtaaaccacaatatgaaaccagacaacagatccaaaagagaatctagtgttgatgcaatgactgctaatgatctgctctcgatgga |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27309256 |
tcatggcattggaagtaaaccacaatatgaaaccagacaacagatccaaaagagaatctagtgttgatgcaatgaccgctaatgatctgctctcgatgga |
27309355 |
T |
|
| Q |
330 |
cgcgaaaacctttgct |
345 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
27309356 |
cgcgaaaacctttgct |
27309371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 174 - 323
Target Start/End: Original strand, 18644877 - 18645026
Alignment:
| Q |
174 |
taccactggttgcatacgtttctttccaatcggatagtgatatcggtttggcttgctcatggcattggaagtaaaccacaatatgaaaccagacaacaga |
273 |
Q |
| |
|
|||||| || ||||| |||||||||||||| ||||||||| | ||||||| | |||||||||||| ||| |||||||||||||| || ||||| ||| |
|
|
| T |
18644877 |
taccaccggctgcatccgtttctttccaattggatagtgaaaatggtttggtgttttcatggcattggcagtgaaccacaatatgaaccccgacaaaaga |
18644976 |
T |
|
| Q |
274 |
tccaaaagagaatctagtgttgatgcaatgactgctaatgatctgctctc |
323 |
Q |
| |
|
||||| |||||||| | || || ||||| || ||||||||||||||||| |
|
|
| T |
18644977 |
tccaagagagaatccaaggtggaagcaatcacagctaatgatctgctctc |
18645026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1451 times since January 2019
Visitors: 3084