View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_98 (Length: 334)
Name: NF0412_low_98
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_98 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 78 - 321
Target Start/End: Original strand, 9884102 - 9884345
Alignment:
Q |
78 |
gagatgaagttgttgtctgacgcacaaggtagtgtctccgtttctgattccagtggtaagatcgtgttgacagttgatgaatttgctgctctaagtggaa |
177 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
9884102 |
gagatgaagttgttgtctgacgcacaaggtagtgtctccgtttctgattccagtggtaagatcgtgttgacagttaatgaatttgctgctctaagtggaa |
9884201 |
T |
 |
Q |
178 |
aaatcaatgaatgtgaagatttgattgagaggacagaaacaactgcaatggctcaggtggaagcaatcaacacaagaagaaatgaagtgaacaaaaaagt |
277 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9884202 |
aaatcaatgaatgtgaagatttgattgagaggacagaaacaactgcaatggctcaggtggaagcaatcaacacaagaagaaatgaagtgaacaaaaaagt |
9884301 |
T |
 |
Q |
278 |
cgaagctaatcttcaagcaatcgaagaaataaaagcagcaacag |
321 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9884302 |
cgaagctaatcttcaagcaatcgaagaaataaaagcagcaacag |
9884345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 922 times since January 2019
Visitors: 3072