View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0414_low_2 (Length: 504)
Name: NF0414_low_2
Description: NF0414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0414_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 191 - 466
Target Start/End: Complemental strand, 41077059 - 41076785
Alignment:
| Q |
191 |
tttttctttattctatatcctaacaggtctggactctgttaccattgaagacggctccggtttagtcagaacagaacgcactggttccactcacctctgt |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41077059 |
tttttctttattctatatcctaacaggtctggactctgttaccattgaagacggctccggtttagtcagaacagaacgcactggttccactcacctctgt |
41076960 |
T |
 |
| Q |
291 |
accccatatacttatctcgctgttaataatgctttgtgtatccaaagcaagccataacttaatctcaaattttggtagcagaatattgtgtgttgaattt |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41076959 |
accccatatacttatctcgctgttaataatgctttgtgtatccaaagcaagccataacttaatctcaaattttggtagcagaatattgtgtgttgaattt |
41076860 |
T |
 |
| Q |
391 |
cacccattttcttttctgagaatgatctcaaaacnnnnnnncaatgttgatgcacggtccaagtaatggtaacctt |
466 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41076859 |
cacccattttcttttctgagaatgatctcaaaac-ggggggcaatgttgatgcacggtccaagtaatggtaacctt |
41076785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 30 - 113
Target Start/End: Complemental strand, 41077220 - 41077137
Alignment:
| Q |
30 |
gttgctacagatttgagcaatttaagtcttcactttgactatgaaggtcttgttaggattatagaataacgggacaaaggatca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41077220 |
gttgctacagatttgagcaatttaagtcttccctttgactatgaaggtcttgttaggattatagaataacgggataaaggatca |
41077137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University