View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0415Ase17 (Length: 76)

Name: NF0415Ase17
Description: NF0415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0415Ase17
NF0415Ase17
[»] chr1 (1 HSPs)
chr1 (7-69)||(39999811-39999873)


Alignment Details
Target: chr1 (Bit Score: 59; Significance: 1e-25; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 7 - 69
Target Start/End: Original strand, 39999811 - 39999873
Alignment:
7 taatgacataaaaaatgcggtcgaggaaaaatgtgccaaaactgtctcttgtgctgacatatt 69  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
39999811 taatgacataaaaaatgcggttgaggaaaaatgtgccaaaactgtctcttgtgctgacatatt 39999873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1738 times since January 2019
Visitors: 3234