View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0415Ase17 (Length: 76)
Name: NF0415Ase17
Description: NF0415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0415Ase17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 59; Significance: 1e-25; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 7 - 69
Target Start/End: Original strand, 39999811 - 39999873
Alignment:
Q |
7 |
taatgacataaaaaatgcggtcgaggaaaaatgtgccaaaactgtctcttgtgctgacatatt |
69 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39999811 |
taatgacataaaaaatgcggttgaggaaaaatgtgccaaaactgtctcttgtgctgacatatt |
39999873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University