View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0415Ase4 (Length: 73)
Name: NF0415Ase4
Description: NF0415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0415Ase4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 40; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 10 - 53
Target Start/End: Original strand, 1908114 - 1908157
Alignment:
| Q |
10 |
tattctattactttaaagaatttaatgtaataacgtaacaaaaa |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1908114 |
tattctattactttaaagaatttaatgtaataatgtaacaaaaa |
1908157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University