View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0415_high_10 (Length: 252)
Name: NF0415_high_10
Description: NF0415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0415_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 14 - 228
Target Start/End: Original strand, 40213966 - 40214180
Alignment:
Q |
14 |
agatatatatgctttctaaagtaatagttctagatattaaattagtgttggattggatgttttattttttcacaagcaaaaatgatttatcaatattcat |
113 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
40213966 |
agatatatatgctttctaaagtaatagttctagatattaaattagtgttggattggatgttttattttttcacaagcaaaaacgatttatcaatattcat |
40214065 |
T |
 |
Q |
114 |
ttatgctaattctcctgcactgaccctttattatattatttgtatgaatattatttatttctgccatgcatgcagggaacaaattaatgttgaaccggac |
213 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40214066 |
ttatgctaattctcctgcactgaacctttattatattatttctatgaatattatttatttctgccatgcatgcagggaacaaattaatgttgaaccggac |
40214165 |
T |
 |
Q |
214 |
ccgcattgagtaaga |
228 |
Q |
|
|
||||||||||||||| |
|
|
T |
40214166 |
ccgcattgagtaaga |
40214180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 84 times since January 2019
Visitors: 3256