View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0415_high_13 (Length: 243)
Name: NF0415_high_13
Description: NF0415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0415_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 53557124 - 53557331
Alignment:
| Q |
1 |
tcctcaaaaaattggtaaatannnnnnnncttaatttttgtaattactagtacttcttagattatatatatgtatgtattgatcacaagggaattattat |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
53557124 |
tcctcaaaaaattggtaaatattttttttcttaatttttgt---tactagtacttcttagattata----tgtatgtattgatcacaagggaattattat |
53557216 |
T |
|
| Q |
101 |
tttctctttgtggtcgtagtacctcttgtacttttttcatctgggtttgaataaaattatttgtttgctgatcaaacaagaaaattgtatactacgagaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53557217 |
tttctctttgtggtcgtagtacctcttgtacttttttcatctgagtttgaataaaattatttgtttgctgatcaaacaagaaaattgtatactacgagaa |
53557316 |
T |
|
| Q |
201 |
aattatgtgaaatct |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
53557317 |
aattatgtgaaatct |
53557331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 318 times since January 2019
Visitors: 3263