View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0415_high_16 (Length: 207)
Name: NF0415_high_16
Description: NF0415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0415_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 5751160 - 5751265
Alignment:
Q |
1 |
tttctttgttattaattgattccataaactaagattgcctatatttgtctatgaaggtatcgggtatgggtatgtatggcatttgccattgattggtagc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5751160 |
tttctttgttattaattgattccataaactaagattgcctatatttgtctatgaaggtatcgggtatgggtatgtatggcatttgccattgattggtagc |
5751259 |
T |
 |
Q |
101 |
tattat |
106 |
Q |
|
|
|||||| |
|
|
T |
5751260 |
tattat |
5751265 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University