View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0415_high_8 (Length: 309)
Name: NF0415_high_8
Description: NF0415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0415_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 12 - 280
Target Start/End: Original strand, 19539859 - 19540126
Alignment:
| Q |
12 |
agagatcagtatccatacggggtatgtggagagtgggaggtggtaaaggaatttgaatttgggagatggcttggctgcctttccgacatggctacaaagt |
111 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19539859 |
agagatcagtatccatgcggg-tatgtggagagtgggaggttgtaatggaatttgaatttgggagatggcttggctgcctttccgacatggctacaaagt |
19539957 |
T |
 |
| Q |
112 |
gtagtccccaaaaccaggtaattgtgttacttgttctcctttgtgtgttgtatcatgtatgagacatttgtattgaaataattgatcatttgtttatgga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19539958 |
gtagtccccaaaaccaggtaattgtgttacttgttctcctttgtgtgttgtatcatgtatgagacatttgtattgaaataattgatcatttgtttatgga |
19540057 |
T |
 |
| Q |
212 |
gtgtaattgggcgagatcagtctggctcacatccctcttgaaacattcgaaacaatgtgaatcagatct |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19540058 |
gtgtaattgggcgagatcagtctggctcacatccctcttgaaacattcgaaacaatgtgaatcagatct |
19540126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University