View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0415_low_11 (Length: 309)
Name: NF0415_low_11
Description: NF0415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0415_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 95 - 240
Target Start/End: Original strand, 38160802 - 38160947
Alignment:
Q |
95 |
ctttgaactttgaaatatgcaggattcacaaggagcaggtcgaaaagtggcaggaagaaatcaaagaattgcgggcacttgatgcctcaaatgaggaagc |
194 |
Q |
|
|
|||| |||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
T |
38160802 |
cttttaactttccaatatgcaggattcacaaggagcaggtcgaaaaatggcaggaagaaatcaaagaactgcgtgcacttgatgcctcaaatgaggaagc |
38160901 |
T |
 |
Q |
195 |
caaagctcttctgcaaaatgctcgatacgtacttcatctcactcga |
240 |
Q |
|
|
||| ||||||||||||||||||||||| |||||||| ||||||||| |
|
|
T |
38160902 |
caatgctcttctgcaaaatgctcgatatgtacttcagctcactcga |
38160947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 95 - 239
Target Start/End: Original strand, 38116976 - 38117120
Alignment:
Q |
95 |
ctttgaactttgaaatatgcaggattcacaaggagcaggtcgaaaagtggcaggaagaaatcaaagaattgcgggcacttgatgcctcaaatgaggaagc |
194 |
Q |
|
|
|||| |||||| ||||| |||||||||||||||||||||| ||||| ||||||||||||||||||||| | || ||||| |||||||||||||||||||| |
|
|
T |
38116976 |
cttttaactttcaaataagcaggattcacaaggagcaggttgaaaaatggcaggaagaaatcaaagaactccgtgcactcgatgcctcaaatgaggaagc |
38117075 |
T |
 |
Q |
195 |
caaagctcttctgcaaaatgctcgatacgtacttcatctcactcg |
239 |
Q |
|
|
||| ||||||||||||||||||||||| |||||||| |||||||| |
|
|
T |
38117076 |
caatgctcttctgcaaaatgctcgatatgtacttcagctcactcg |
38117120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 95 - 239
Target Start/End: Original strand, 49004779 - 49004923
Alignment:
Q |
95 |
ctttgaactttgaaatatgcaggattcacaaggagcaggtcgaaaagtggcaggaagaaatcaaagaattgcgggcacttgatgcctcaaatgaggaagc |
194 |
Q |
|
|
|||| |||||| ||||| |||||||||||||||||||||| ||||| ||||||||||||||||||||| | || ||||| |||||||||||||||||||| |
|
|
T |
49004779 |
cttttaactttcaaataagcaggattcacaaggagcaggttgaaaaatggcaggaagaaatcaaagaactccgagcactcgatgcctcaaatgaggaagc |
49004878 |
T |
 |
Q |
195 |
caaagctcttctgcaaaatgctcgatacgtacttcatctcactcg |
239 |
Q |
|
|
||| ||||||||||||||||||||||| |||||||| |||||||| |
|
|
T |
49004879 |
caatgctcttctgcaaaatgctcgatatgtacttcagctcactcg |
49004923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13 times since January 2019
Visitors: 3252