View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0415_low_12 (Length: 309)

Name: NF0415_low_12
Description: NF0415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0415_low_12
NF0415_low_12
[»] chr7 (1 HSPs)
chr7 (12-280)||(19539859-19540126)


Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 12 - 280
Target Start/End: Original strand, 19539859 - 19540126
Alignment:
12 agagatcagtatccatacggggtatgtggagagtgggaggtggtaaaggaatttgaatttgggagatggcttggctgcctttccgacatggctacaaagt 111  Q
    |||||||||||||||| |||| ||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
19539859 agagatcagtatccatgcggg-tatgtggagagtgggaggttgtaatggaatttgaatttgggagatggcttggctgcctttccgacatggctacaaagt 19539957  T
112 gtagtccccaaaaccaggtaattgtgttacttgttctcctttgtgtgttgtatcatgtatgagacatttgtattgaaataattgatcatttgtttatgga 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19539958 gtagtccccaaaaccaggtaattgtgttacttgttctcctttgtgtgttgtatcatgtatgagacatttgtattgaaataattgatcatttgtttatgga 19540057  T
212 gtgtaattgggcgagatcagtctggctcacatccctcttgaaacattcgaaacaatgtgaatcagatct 280  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19540058 gtgtaattgggcgagatcagtctggctcacatccctcttgaaacattcgaaacaatgtgaatcagatct 19540126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University