View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0415_low_14 (Length: 260)
Name: NF0415_low_14
Description: NF0415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0415_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 82 - 163
Target Start/End: Complemental strand, 48845633 - 48845552
Alignment:
| Q |
82 |
ggattaatttgctaatattgaagctaatttaatcaatagtcttgcttaaatggaataagaatggtgtagtactcttcaaaat |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48845633 |
ggattaatttgctaatattgaagctaatttaatcaatagtcttgcttaaatggaataagaatggtgtagtactcttcaaaat |
48845552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 82 - 163
Target Start/End: Original strand, 7016912 - 7016993
Alignment:
| Q |
82 |
ggattaatttgctaatattgaagctaatttaatcaatagtcttgcttaaatggaataagaatggtgtagtactcttcaaaat |
163 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7016912 |
ggattaatttgctgatattgaagctaatttaatcaatcgtcttgcttaaatggaataagaatgatgtagtactcttcaaaat |
7016993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 87 - 163
Target Start/End: Complemental strand, 42994971 - 42994895
Alignment:
| Q |
87 |
aatttgctaatattgaagctaatttaatcaatagtcttgcttaaatggaataagaatggtgtagtactcttcaaaat |
163 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
42994971 |
aatttgttgatattgaagctaatttaatcaatagtcttgcttaaatggaataagaatggcgtggtactcttcaaaat |
42994895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 41 times since January 2019
Visitors: 3251