View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0415_low_19 (Length: 213)
Name: NF0415_low_19
Description: NF0415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0415_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 23135025 - 23135127
Alignment:
| Q |
1 |
tttggaaggggtaggccagttttgtttctagttgttagatgattaagggcattgaacctgttattttttgttgtaacggttttttggggatttatgatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23135025 |
tttggaaggggtaggccagttttgtttctagttgttagatgattaagggcattgaacctgttattttttgttgtaacggttttttggggatttatgatga |
23135124 |
T |
|
| Q |
101 |
tgt |
103 |
Q |
| |
|
||| |
|
|
| T |
23135125 |
tgt |
23135127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 11894855 - 11894753
Alignment:
| Q |
1 |
tttggaaggggtaggccagttttgtttctagttgttagatgattaagggcattgaacctgttattttttgttgtaacggttttttggggatttatgatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11894855 |
tttggaaggggtaggccagttttgtttctagttgttagatgattaagggcattgaacctgttattttttgttgtaacggttttttggggatttatgatga |
11894756 |
T |
|
| Q |
101 |
tgt |
103 |
Q |
| |
|
||| |
|
|
| T |
11894755 |
tgt |
11894753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 20282556 - 20282454
Alignment:
| Q |
1 |
tttggaaggggtaggccagttttgtttctagttgttagatgattaagggcattgaacctgttattttttgttgtaacggttttttggggatttatgatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20282556 |
tttggaaggggtaggccagttttgtttctagttgttagatgattaagggcattgaacctgttattttttgttgtaacggttttttggggatttatgatga |
20282457 |
T |
|
| Q |
101 |
tgt |
103 |
Q |
| |
|
||| |
|
|
| T |
20282456 |
tgt |
20282454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 141 - 206
Target Start/End: Complemental strand, 20753368 - 20753303
Alignment:
| Q |
141 |
ttgcgatataaatataaacattattatgaatattaagcaaaataaatattgaaatttatgagttaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20753368 |
ttgcgatataaatataaacattattatgaatattgagcaaaataaatattgaaatttatgagttaa |
20753303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 141 - 206
Target Start/End: Complemental strand, 20754114 - 20754049
Alignment:
| Q |
141 |
ttgcgatataaatataaacattattatgaatattaagcaaaataaatattgaaatttatgagttaa |
206 |
Q |
| |
|
||||||||| ||| ||||||||||||| | |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
20754114 |
ttgcgatatgaatgtaaacattattataattattgagcaaaataaatattagaatttatgagttaa |
20754049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 14 - 99
Target Start/End: Original strand, 14656145 - 14656230
Alignment:
| Q |
14 |
ggccagttttgtttctagttgttagatgattaagggcattgaacctgttattttttgttgtaacggttttttggggatttatgatg |
99 |
Q |
| |
|
|||||| |||||||||| | |||||| |||||||||||||| ||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
14656145 |
ggccagctttgtttctaatagttagactgttaagggcattgaatttgttaattttttatgtaacggttttttgtggatttatgatg |
14656230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 141 - 206
Target Start/End: Complemental strand, 17390667 - 17390602
Alignment:
| Q |
141 |
ttgcgatataaatataaacattattatgaatattaagcaaaataaatattgaaatttatgagttaa |
206 |
Q |
| |
|
||||||||| ||| ||||||||||||| | |||| || | ||||||||||| ||||| |||||||| |
|
|
| T |
17390667 |
ttgcgatatgaatgtaaacattattatcattattgagaagaataaatattggaatttctgagttaa |
17390602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1898 times since January 2019
Visitors: 3241