View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0415_low_4 (Length: 479)
Name: NF0415_low_4
Description: NF0415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0415_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 3e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 9 - 115
Target Start/End: Complemental strand, 10974104 - 10973998
Alignment:
| Q |
9 |
gataattctagaatttataaaaacttaaacttaggtttgaggtgatggcaccaaaaagaaatggagatgaggctgtgaaaagtgggaatcaaaaatatgt |
108 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
10974104 |
gataattctagaatttatataaacttaaacttaggtttgaggtgatggcaccaaaaagaaatggagatgaggctgtggaaagtgggaaccaaaaatatgt |
10974005 |
T |
|
| Q |
109 |
ccggcac |
115 |
Q |
| |
|
||||||| |
|
|
| T |
10974004 |
ccggcac |
10973998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 239 - 328
Target Start/End: Original strand, 47063063 - 47063148
Alignment:
| Q |
239 |
atgtatgtaatgtttctttgcagcgatgtggaactagaaggcgttgtttctactatatatctactatccactcccaccccaaacttggca |
328 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||| ||||||| ||||||| |||||||| ||||||| |||||| ||||||||| |
|
|
| T |
47063063 |
atgtatgaaatgtttctttgcagcgatgtgggactaccaggcgttatttctac----tatctactctccactctcacccccaacttggca |
47063148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 204 - 269
Target Start/End: Original strand, 47026785 - 47026850
Alignment:
| Q |
204 |
tgactttgtcaaaggcacttatataagatatcttcatgtatgtaatgtttctttgcagcgatgtgg |
269 |
Q |
| |
|
||||| ||||||||||| |||||||| | || | |||||||| ||||||| ||||||||||||||| |
|
|
| T |
47026785 |
tgactctgtcaaaggcaattatataaaacatgtccatgtatgcaatgtttgtttgcagcgatgtgg |
47026850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 47030738 - 47030790
Alignment:
| Q |
222 |
ttatataagatatcttcatgtatgtaatgtttctttgcagcgatgtggaacta |
274 |
Q |
| |
|
|||||||||||||||||| |||| |||||| ||||| |||||||||| |||| |
|
|
| T |
47030738 |
ttatataagatatcttcaagtatagaatgttactttggagcgatgtgggacta |
47030790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 239 - 283
Target Start/End: Original strand, 47061535 - 47061579
Alignment:
| Q |
239 |
atgtatgtaatgtttctttgcagcgatgtggaactagaaggcgtt |
283 |
Q |
| |
|
||||||| |||||||||||| |||||||||| |||| |||||||| |
|
|
| T |
47061535 |
atgtatgcaatgtttctttgaagcgatgtgggactaaaaggcgtt |
47061579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1543 times since January 2019
Visitors: 3232