View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0415_low_8 (Length: 388)
Name: NF0415_low_8
Description: NF0415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0415_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 5 - 205
Target Start/End: Original strand, 36932384 - 36932584
Alignment:
| Q |
5 |
caagagacgcattgaagcaactagcaacagagaacgaaaatcaaagaagtgggaacaatgtcgtttatgaaaggagatttgctttctcggtccagaaagc |
104 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36932384 |
caagaggcgcattgaagcaactagcaacagagaacgaaaatcaaagaagtgggaacaatgtcgtttatgaaaggagatttgctttctcggtccagaaagc |
36932483 |
T |
 |
| Q |
105 |
tcgtgaagggtttggccaaggccgagcccgtttggctcaaagccatggaacagttaatctcctgatctttcatgtttgaacttattttctcatacaatgt |
204 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36932484 |
tcgtcaagggtttggccaaggccgagcccgtttggctcaaagccatggaacagttaatctcctgatctttcatgtttgaacttattttctcttacaatgt |
36932583 |
T |
 |
| Q |
205 |
c |
205 |
Q |
| |
|
| |
|
|
| T |
36932584 |
c |
36932584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 239 - 302
Target Start/End: Original strand, 36932598 - 36932661
Alignment:
| Q |
239 |
gtgccacttgagaatctcctatctagatttttatcgttgatgactctttttgctgcacaatggt |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
36932598 |
gtgccacttgagaatctcctatctagatttttatctttgatgactctttttgttgcacaatggt |
36932661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 96; Significance: 6e-47; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 49 - 160
Target Start/End: Original strand, 990311 - 990422
Alignment:
| Q |
49 |
agaagtgggaacaatgtcgtttatgaaaggagatttgctttctcggtccagaaagctcgtgaagggtttggccaaggccgagcccgtttggctcaaagcc |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| || ||||||||||||||| |
|
|
| T |
990311 |
agaagtgggaacaatgtcgtttatgaaaggagatttgctttctcggtccagaaagctcgtcaagggtttggccatggccgaacctgtttggctcaaagcc |
990410 |
T |
 |
| Q |
149 |
atggaacagtta |
160 |
Q |
| |
|
|||||||||||| |
|
|
| T |
990411 |
atggaacagtta |
990422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University