View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0415eco11 (Length: 191)
Name: NF0415eco11
Description: NF0415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0415eco11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 4e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 4e-89
Query Start/End: Original strand, 8 - 188
Target Start/End: Original strand, 41256649 - 41256827
Alignment:
Q |
8 |
atttaggttggtaaaagtaaaactaaaacaacagagaaatagacacaatcacatatagcatgtgacaagctataatgattcatgaaactgccgtttgagt |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
41256649 |
atttaggttggtaaaagtaaaactaaaacaacagagaaatagacacaatcacatatagcatgtgacaagctataatgattcatgaaactgccgtttgaat |
41256748 |
T |
 |
Q |
108 |
taggcaaggcgttcaatacttatatttattattatgagcatttgctgttggagggaaacatgtccacgggtttatcaattg |
188 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41256749 |
taggcaaggcgttcaatact--tatttattattatgagcatttgctgttggagggaaacatgtccacgggtttatcaattg |
41256827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University