View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0415eco25 (Length: 123)
Name: NF0415eco25
Description: NF0415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0415eco25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 2e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 10 - 119
Target Start/End: Original strand, 17970785 - 17970894
Alignment:
Q |
10 |
tacgatttgttttctctcttgaaaaaggtggattcgttttttatcttcctccatgttttcggttaaaagaatcaattaatggttctctccattaatttcg |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
17970785 |
tacgatttgttttctctcttgaaaaaggtggattcgttttttatcttcctccatgttttcggttaaaagaatcaattaatggttctctccattaatttcg |
17970884 |
T |
 |
Q |
110 |
tttatgaatt |
119 |
Q |
|
|
|||| ||||| |
|
|
T |
17970885 |
tttacgaatt |
17970894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University