View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0416-Insertion-5 (Length: 122)
Name: NF0416-Insertion-5
Description: NF0416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0416-Insertion-5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 4e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 7 - 119
Target Start/End: Original strand, 18997887 - 18997999
Alignment:
| Q |
7 |
aaatgtaacgtcaaaaactgagatacaaccaacattatcagatgtttctgatgatgttgatggtgtgaggaaggggaagtttacgttgtattacaaggag |
106 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
18997887 |
aaatgtaacgtcaaaaactgagacaccaccaacattatcagatgtttctgatgatgttgatggtgtaaggaaggggaagtttaccttgtattacaaggag |
18997986 |
T |
|
| Q |
107 |
gacatgcaatgtg |
119 |
Q |
| |
|
||||||||||||| |
|
|
| T |
18997987 |
gacatgcaatgtg |
18997999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1373 times since January 2019
Visitors: 3229