View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0416-Insertion-6 (Length: 47)
Name: NF0416-Insertion-6
Description: NF0416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0416-Insertion-6 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 40; Significance: 0.00000000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000001
Query Start/End: Original strand, 8 - 47
Target Start/End: Complemental strand, 27831435 - 27831396
Alignment:
| Q |
8 |
cgatcaacaccaagtttggaacattcataatgtcatcact |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27831435 |
cgatcaacaccaagtttggaacattcataatgtcatcact |
27831396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.0000000007
Query Start/End: Original strand, 8 - 47
Target Start/End: Complemental strand, 27846666 - 27846627
Alignment:
| Q |
8 |
cgatcaacaccaagtttggaacattcataatgtcatcact |
47 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
27846666 |
cgatcaacactaagtttggaacattcttaatgtcatcact |
27846627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1523 times since January 2019
Visitors: 3232