View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0416_low_2 (Length: 257)
Name: NF0416_low_2
Description: NF0416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0416_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 57 - 215
Target Start/End: Complemental strand, 39986807 - 39986649
Alignment:
| Q |
57 |
cattttaattcaaaattttctgttggaatattgatttaaattgaagtggtgaaacatagcttttgaattgtgattgataatttgcactaaatttgaatac |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39986807 |
cattttaattcaaaattttctgttggaatattgatttaaattgaagtgatgaaacatagcttttgaattgtgattgataatttgcactaaatttgaatac |
39986708 |
T |
 |
| Q |
157 |
aaacttacatttaagtgaaaaaatttaaatatataattttacttcaaacttacttatca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39986707 |
aaacttacatttaagtgaaaaaatttaaatatataattttacttcaaacttacttatca |
39986649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 229 - 257
Target Start/End: Complemental strand, 39986637 - 39986609
Alignment:
| Q |
229 |
ggtagatcaaacttacttatcattaactt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39986637 |
ggtagatcaaacttacttatcattaactt |
39986609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University