View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0416_low_3 (Length: 255)
Name: NF0416_low_3
Description: NF0416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0416_low_3 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 57 - 255
Target Start/End: Complemental strand, 39986807 - 39986609
Alignment:
Q |
57 |
cattttaattcaaaattttctgttggaatattgatttaaattgaagtggtgaaacatagcttttgaattgtgattgataatttgcactaaatttgaatac |
156 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39986807 |
cattttaattcaaaattttctgttggaatattgatttaaattgaagtgatgaaacatagcttttgaattgtgattgataatttgcactaaatttgaatac |
39986708 |
T |
 |
Q |
157 |
aaacttacatttaagtgaaaaaatttaaatatataattttacttcaaacttacttatcannnnnnnnnnnggtagatcaaacttacttatcattaactt |
255 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
39986707 |
aaacttacatttaagtgaaaaaatttaaatatataattttacttcaaacttacttatcatttttttttttggtagatcaaacttacttatcattaactt |
39986609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1602 times since January 2019
Visitors: 3232