View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0417_low_5 (Length: 234)
Name: NF0417_low_5
Description: NF0417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0417_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 153
Target Start/End: Complemental strand, 7766970 - 7766818
Alignment:
Q |
1 |
tccgcggtgacatggtgagtcctagtaatttgctcaccctggtgatgaagggtgacaaatgtcttggtagcattctctcttatgttctctgctatcttta |
100 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7766970 |
tccgcggcgacatggtgagtcctagtaatttgctcaccctggtgatgaagggtgacaaatgtcttggtagcattctctcttatgttctctgctatcttta |
7766871 |
T |
 |
Q |
101 |
aacaattctggaccgatttcgtagtctcctcagccttgtgaacagtataatct |
153 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
7766870 |
aacaattctggaccgatttcgtagtctcctcagccttgtgaacagcataatct |
7766818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 9 - 151
Target Start/End: Original strand, 45392557 - 45392699
Alignment:
Q |
9 |
gacatggtgagtcctagtaatttgctcaccctggtgatgaagggtgacaaatgtcttggtagcattctctcttatgttctctgctatctttaaacaattc |
108 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |||||||||||||||||||||||| |||||||| |
|
|
T |
45392557 |
gacatggtgactcctagtaatttgctcaccctggtgatgaagggtgaccaatgtcttggcagcatcctctcttatgttctctgctatcttcaaacaattg |
45392656 |
T |
 |
Q |
109 |
tggaccgatttcgtagtctcctcagccttgtgaacagtataat |
151 |
Q |
|
|
|| |||||||| ||||||||||||||||||| ||||| ||||| |
|
|
T |
45392657 |
tgtaccgatttggtagtctcctcagccttgtaaacagcataat |
45392699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University