View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0417_low_6 (Length: 215)

Name: NF0417_low_6
Description: NF0417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0417_low_6
NF0417_low_6
[»] chr1 (1 HSPs)
chr1 (56-165)||(30417173-30417282)


Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 56 - 165
Target Start/End: Complemental strand, 30417282 - 30417173
Alignment:
56 gctttgatcaattccttttcaaatattaatgttgttgttgttatccagggagacattccactgcagggagacttctctgctgaacatatgatattcggtg 155  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30417282 gctttgatcaattccttttcaaatattaatgttgttgttgttatccagggagacattccactgcagggagacttctctgctgaacatatgatattcggtg 30417183  T
156 gtgggttttc 165  Q
    ||||||||||    
30417182 gtgggttttc 30417173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 57 times since January 2019
Visitors: 3244