View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0417_low_7 (Length: 211)
Name: NF0417_low_7
Description: NF0417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0417_low_7 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 57 - 154
Target Start/End: Complemental strand, 42010418 - 42010321
Alignment:
| Q |
57 |
gcttttgaatcttgtaaagctgaggagataaacgtgatgaagacgatgatgatgacgacattggtgtttcagccaatactcgagacacaggttctgct |
154 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
42010418 |
gcttttgaatcttgtaaagccgaggagataaacgtgatgaagacgatgatgatgacggcattggtgtttcagccaatactcgagccacagtttctgct |
42010321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 57 - 154
Target Start/End: Complemental strand, 1245756 - 1245659
Alignment:
| Q |
57 |
gcttttgaatcttgtaaagctgaggagataaacgtgatgaagacgatgatgatgacgacattggtgtttcagccaatactcgagacacaggttctgct |
154 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| | ||||||| |||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
1245756 |
gcttttgaatcttgtaaagccgaggagataaacgtgatgaagacgataaagatgacggcattggtgtttcagccaatactcgagccacagtttctgct |
1245659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 159 - 211
Target Start/End: Original strand, 3762512 - 3762564
Alignment:
| Q |
159 |
cactgtcaccaacaacaggcatctccctacccttattaagagctggattcctc |
211 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3762512 |
cactgccaccaacaacaggcatctccctaaccttattaagagctggattcctc |
3762564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1783 times since January 2019
Visitors: 3237