View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0418_high_11 (Length: 272)
Name: NF0418_high_11
Description: NF0418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0418_high_11 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 26 - 272
Target Start/End: Original strand, 33465045 - 33465291
Alignment:
Q |
26 |
caataccaaagaatgatggaagaacaagctgaatatgatcaagaagctttacagcttttgaacgatttaatgacaaaaagagagaaagagaagcaagaac |
125 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33465045 |
caataccaaagaatgatggaagaacaagctgaatatgatcaagaagctttacagcttttgaacgatttaatgacaaaaagagagaaagagaagcaagaac |
33465144 |
T |
 |
Q |
126 |
ttgagaaggaattggaagagtatagggaaaaagttatggattatgaagcaaaagagaaattaagaatgttgagaagaatgaaagatggaagtgtaagaag |
225 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33465145 |
ttgagaaggaattggaagagtatagggaaaaagttatggattatgaagcaaaagagaaattaagaatgttgagaagaatgaaagatggaagtgtaagaag |
33465244 |
T |
 |
Q |
226 |
tagagactcttcttgttcttgttgcaacaccggctacaccgatgaac |
272 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33465245 |
tagagactcttcttgttcttgttgcaacaccggctacaccgatgaac |
33465291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University