View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0418_high_2 (Length: 416)
Name: NF0418_high_2
Description: NF0418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0418_high_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 108 - 158
Target Start/End: Complemental strand, 16984402 - 16984352
Alignment:
| Q |
108 |
gaagttattctaagcgttacactaaattctatgctaccatcggttaagagg |
158 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
16984402 |
gaagttattctaagcgttacactaaattttatgctaccattggttaagagg |
16984352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6 times since January 2019
Visitors: 3252