View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0418_high_6 (Length: 294)
Name: NF0418_high_6
Description: NF0418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0418_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 7 - 265
Target Start/End: Original strand, 37698000 - 37698259
Alignment:
Q |
7 |
gtgagatgaactaatttacttttaggaaaggtagagagtttgtacacattgatccatttgagtgaggagttacctgttgctttcaggatgctgaataaag |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37698000 |
gtgagatgaactaatttacttttaggaaaggtagagagtttgtacacattgatccatttgagtgaggagttacctgttgctttcaggatgctgaataaag |
37698099 |
T |
 |
Q |
107 |
agttacatctaacatgaaggagcgtataaaaatcacc-nnnnnnnactttctgagcagcatgttttttcttttgaaacctctgcagcatgttgtttgttc |
205 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37698100 |
agttacatctaacatgatggagcgtataaaaatcaccttttttttactttctgagcagcatgttttttcttttgaaacctctgcagcatgttgtttgttc |
37698199 |
T |
 |
Q |
206 |
tactataaacgacaatttcatcatgccatgttcttgtgcattcatttacagcataggatg |
265 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37698200 |
tactataaacgacaatttcatcatgccatgttcttgtgcattcatttacagcataggatg |
37698259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 98 times since January 2019
Visitors: 3258