View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0418_high_7 (Length: 286)
Name: NF0418_high_7
Description: NF0418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0418_high_7 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] scaffold0168 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 7 - 286
Target Start/End: Original strand, 33465012 - 33465291
Alignment:
| Q |
7 |
gaagcaaaggcggcaatgcagatggaagcattgcaataccaaagaatgatggaagaacaagctgaatatgatcaagaagctttacagcttttgaacgatt |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33465012 |
gaagaaaaggcggcaatgcagatggaagcattgcaataccaaagaatgatggaagaacaagctgaatatgatcaagaagctttacagcttttgaacgatt |
33465111 |
T |
|
| Q |
107 |
taatgacaaaaagagagaaagagaagcaagaacttgagaaggaattggaagagtatagggaaaaagttatggattatgaagcaaaagagaaattaagaat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33465112 |
taatgacaaaaagagagaaagagaagcaagaacttgagaaggaattggaagagtatagggaaaaagttatggattatgaagcaaaagagaaattaagaat |
33465211 |
T |
|
| Q |
207 |
gttgagaagaatgaaagatggaagtgtaagaagtagagactcttcttgttcttgttgcaacaccggctacaccgatgaac |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33465212 |
gttgagaagaatgaaagatggaagtgtaagaagtagagactcttcttgttcttgttgcaacaccggctacaccgatgaac |
33465291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 65
Target Start/End: Original strand, 20559 - 20601
Alignment:
| Q |
23 |
tgcagatggaagcattgcaataccaaagaatgatggaagaaca |
65 |
Q |
| |
|
||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
20559 |
tgcagatggaagctttgcagtatcaaagaatgatggaagaaca |
20601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 119 times since January 2019
Visitors: 3248