View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0418_low_10 (Length: 292)
Name: NF0418_low_10
Description: NF0418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0418_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 87 - 234
Target Start/End: Original strand, 44915187 - 44915334
Alignment:
| Q |
87 |
atttgcttctagtcagcaaggtatgaggttagtcgccaaggcacaacaatttgatacggaaagaatagacggtgcagggataaagggcaatttagaccca |
186 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
44915187 |
atttgcttctagtcagcaaggcatgaggttagtcgccaaggcacaacaatttgatacagaaagaatagatggtgcagggataaagtgcaatttagaccca |
44915286 |
T |
|
| Q |
187 |
caacaagtacggcttcaacaaagaatggcacaacatgcatccatgaga |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44915287 |
caacaagtacggcttcaacaaagaatggcacaacatgcatccatgaga |
44915334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 87 - 170
Target Start/End: Original strand, 7748903 - 7748986
Alignment:
| Q |
87 |
atttgcttctagtcagcaaggtatgaggttagtcgccaaggcacaacaatttgatacggaaagaatagacggtgcagggataaa |
170 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||| | |||||||||| | |||||||||||| |||||||||||||| |
|
|
| T |
7748903 |
atttgcttctggtcagcaaggcatgaggttagttgccaaggaagaacaatttgaaatggaaagaatagatggtgcagggataaa |
7748986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 173 - 234
Target Start/End: Original strand, 7749019 - 7749080
Alignment:
| Q |
173 |
gcaatttagacccacaacaagtacggcttcaacaaagaatggcacaacatgcatccatgaga |
234 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||| |||||||||||| ||||||| |
|
|
| T |
7749019 |
gcaatttagacccacaacaattacggcttcagcaaagaatgccacaacatgcattcatgaga |
7749080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 197 - 234
Target Start/End: Original strand, 2338946 - 2338983
Alignment:
| Q |
197 |
ggcttcaacaaagaatggcacaacatgcatccatgaga |
234 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
2338946 |
ggcttcagcaaagaatgccacaacatgcatccatgaga |
2338983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1887 times since January 2019
Visitors: 3241