View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0418_low_14 (Length: 279)

Name: NF0418_low_14
Description: NF0418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0418_low_14
NF0418_low_14
[»] chr5 (2 HSPs)
chr5 (138-183)||(39315102-39315147)
chr5 (80-114)||(39315044-39315078)


Alignment Details
Target: chr5 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 138 - 183
Target Start/End: Original strand, 39315102 - 39315147
Alignment:
138 tctcattgataaatgatctacttgtaatgttgatgcttcattccga 183  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
39315102 tctcattgataaatgatctacttgtaatgttgatgcttcattccga 39315147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 80 - 114
Target Start/End: Original strand, 39315044 - 39315078
Alignment:
80 caaaggccaacaacaaaatgtggaagggtagctac 114  Q
    |||||||||||||||||||||||||||||||||||    
39315044 caaaggccaacaacaaaatgtggaagggtagctac 39315078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 27 times since January 2019
Visitors: 3252