View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0418_low_14 (Length: 279)
Name: NF0418_low_14
Description: NF0418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0418_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 138 - 183
Target Start/End: Original strand, 39315102 - 39315147
Alignment:
Q |
138 |
tctcattgataaatgatctacttgtaatgttgatgcttcattccga |
183 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39315102 |
tctcattgataaatgatctacttgtaatgttgatgcttcattccga |
39315147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 80 - 114
Target Start/End: Original strand, 39315044 - 39315078
Alignment:
Q |
80 |
caaaggccaacaacaaaatgtggaagggtagctac |
114 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
39315044 |
caaaggccaacaacaaaatgtggaagggtagctac |
39315078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 27 times since January 2019
Visitors: 3252